Transcript: Mouse NM_001291131.1

Mus musculus asialoglycoprotein receptor 1 (Asgr1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Asgr1 (11889)
Length:
1150
CDS:
44..898

Additional Resources:

NCBI RefSeq record:
NM_001291131.1
NBCI Gene record:
Asgr1 (11889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336530 CCCTCATTTATATCCTTAATT pLKO_005 911 3UTR 100% 15.000 10.500 N Asgr1 n/a
2 TRCN0000336529 AGCACCTGGACAATGATAATG pLKO_005 69 CDS 100% 13.200 9.240 N Asgr1 n/a
3 TRCN0000353446 CTGGCTCTAAGGCAGAATTTC pLKO_005 251 CDS 100% 13.200 9.240 N Asgr1 n/a
4 TRCN0000336466 GAGACCAGAGCAGCCAGATAA pLKO_005 748 CDS 100% 13.200 9.240 N Asgr1 n/a
5 TRCN0000336528 ACAAAGTTGGATAAGGCTAAT pLKO_005 875 CDS 100% 10.800 7.560 N Asgr1 n/a
6 TRCN0000094282 CTGTGAGACAAAGTTGGATAA pLKO.1 868 CDS 100% 10.800 7.560 N Asgr1 n/a
7 TRCN0000094281 GTGGGAAGAAAGATGAAGTTA pLKO.1 332 CDS 100% 5.625 3.938 N Asgr1 n/a
8 TRCN0000094279 GAACTGGTAGAGCCTACCTAA pLKO.1 952 3UTR 100% 4.950 3.465 N Asgr1 n/a
9 TRCN0000094280 GACAATGATAATGACCATCAT pLKO.1 77 CDS 100% 0.495 0.347 N Asgr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.