Transcript: Human NM_001291157.2

Homo sapiens eukaryotic translation initiation factor 4 gamma 1 (EIF4G1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
EIF4G1 (1981)
Length:
5465
CDS:
341..5020

Additional Resources:

NCBI RefSeq record:
NM_001291157.2
NBCI Gene record:
EIF4G1 (1981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291157.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236428 GTCATCCCGCATCCGCTTTAT pLKO_005 3133 CDS 100% 13.200 18.480 N EIF4G1 n/a
2 TRCN0000061768 CCCTACAGAATTTGGGACCTA pLKO.1 622 CDS 100% 2.640 3.696 N EIF4G1 n/a
3 TRCN0000061772 CCCAGCTACTAGTACTTTGAA pLKO.1 3562 CDS 100% 0.000 0.000 N EIF4G1 n/a
4 TRCN0000257363 GTCTGCTATTCTGCAATTATT pLKO_005 4676 CDS 100% 15.000 10.500 N EIF4G1 n/a
5 TRCN0000236429 GTGATGTGTCTGAACTAATAA pLKO_005 5131 3UTR 100% 15.000 10.500 N EIF4G1 n/a
6 TRCN0000236431 CTTTAGGGAATATCAAGTTTA pLKO_005 2904 CDS 100% 13.200 9.240 N EIF4G1 n/a
7 TRCN0000061769 GCCCTTGTAGTGACCTTAGAA pLKO.1 4808 CDS 100% 5.625 3.938 N EIF4G1 n/a
8 TRCN0000061771 CCCAAGTAATGATGATCCCTT pLKO.1 474 CDS 100% 2.640 1.848 N EIF4G1 n/a
9 TRCN0000061770 GCAGATAGTATCCAACACGTT pLKO.1 4633 CDS 100% 2.640 1.848 N EIF4G1 n/a
10 TRCN0000236430 AGTGTTAATGACCGAAGATAT pLKO_005 2374 CDS 100% 13.200 7.920 N EIF4G1 n/a
11 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 1595 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
12 TRCN0000145134 GAAGAAGAAGAAGAAGAGGAA pLKO.1 1592 CDS 100% 2.640 1.320 Y ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291157.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.