Transcript: Human NM_001291328.2

Homo sapiens family with sequence similarity 228 member B (FAM228B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
FAM228B (375190)
Length:
1287
CDS:
427..990

Additional Resources:

NCBI RefSeq record:
NM_001291328.2
NBCI Gene record:
FAM228B (375190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144764 GAGGCAGCTATTCAATCAATA pLKO.1 328 5UTR 100% 13.200 9.240 N FAM228B n/a
2 TRCN0000139208 CTGTGCTATCAGGAGGGAAAT pLKO.1 844 CDS 100% 10.800 7.560 N FAM228B n/a
3 TRCN0000144369 CCAGATTCCCACAAATTTCTA pLKO.1 599 CDS 100% 5.625 3.938 N FAM228B n/a
4 TRCN0000122095 CTGCCTACAAGATACATAGAA pLKO.1 658 CDS 100% 5.625 3.938 N FAM228B n/a
5 TRCN0000144842 GAAACTGCCTACAAGATACAT pLKO.1 654 CDS 100% 5.625 3.938 N FAM228B n/a
6 TRCN0000122096 CCTACAAGATACATAGAAAGT pLKO.1 661 CDS 100% 4.950 3.465 N FAM228B n/a
7 TRCN0000140154 GAAGGTTACCATCCCACCATT pLKO.1 453 CDS 100% 4.950 3.465 N FAM228B n/a
8 TRCN0000122497 CTTCAGTGTGAGACTGGCAAA pLKO.1 529 CDS 100% 4.050 2.835 N FAM228B n/a
9 TRCN0000145483 GCACTTTATAACTCCAAACGA pLKO.1 627 CDS 100% 3.000 2.100 N FAM228B n/a
10 TRCN0000144203 CAAGGCACTTTATAACTCCAA pLKO.1 623 CDS 100% 2.640 1.848 N FAM228B n/a
11 TRCN0000144492 CCATTTCATGACCCTTTGAAA pLKO.1 469 CDS 100% 0.563 0.394 N FAM228B n/a
12 TRCN0000139994 GAAAGAGAACCGCTGTGCTAT pLKO.1 832 CDS 100% 4.950 2.970 N FAM228B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.