Transcript: Human NM_001291478.2

Homo sapiens A-kinase anchoring protein 8 like (AKAP8L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
AKAP8L (26993)
Length:
1895
CDS:
66..1823

Additional Resources:

NCBI RefSeq record:
NM_001291478.2
NBCI Gene record:
AKAP8L (26993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038002 CCGCAGTATTCTCAACAACAA pLKO.1 1460 CDS 100% 4.950 6.930 N AKAP8L n/a
2 TRCN0000038003 CGACTTCCGAACCAAGAAGAA pLKO.1 689 CDS 100% 4.950 6.930 N AKAP8L n/a
3 TRCN0000037999 CGTCACTAACAAGACCAAGAA pLKO.1 1187 CDS 100% 4.950 6.930 N AKAP8L n/a
4 TRCN0000234541 ACCACTTTGCAGTCGACATAC pLKO_005 99 CDS 100% 10.800 8.640 N AKAP8L n/a
5 TRCN0000234542 TTGGAACTCTGGGACAAATAG pLKO_005 164 CDS 100% 13.200 9.240 N AKAP8L n/a
6 TRCN0000234543 AGGATAACACCACCAACTATG pLKO_005 223 CDS 100% 10.800 7.560 N AKAP8L n/a
7 TRCN0000088483 CCCACCTGTGATTATGGATAT pLKO.1 138 CDS 100% 10.800 7.560 N Akap8l n/a
8 TRCN0000234544 CTGCAGGAGTACGTCACTAAC pLKO_005 1176 CDS 100% 10.800 7.560 N AKAP8L n/a
9 TRCN0000038000 CCTGTGATTATGGATATGGAA pLKO.1 142 CDS 100% 3.000 2.100 N AKAP8L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.