Transcript: Human NM_001291641.2

Homo sapiens golgi associated, gamma adaptin ear containing, ARF binding protein 3 (GGA3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
GGA3 (23163)
Length:
4040
CDS:
405..2360

Additional Resources:

NCBI RefSeq record:
NM_001291641.2
NBCI Gene record:
GGA3 (23163)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232887 CCTGTGACAGCCTACGATAAA pLKO_005 1980 CDS 100% 13.200 18.480 N GGA3 n/a
2 TRCN0000232888 GAAGGTGCGGCTTCGGTATAA pLKO_005 2252 CDS 100% 13.200 18.480 N GGA3 n/a
3 TRCN0000065018 CGGGTCATCAACTCTTACAAA pLKO.1 1050 CDS 100% 5.625 7.875 N GGA3 n/a
4 TRCN0000065019 GCACACGTTAGAGGAAGTTAA pLKO.1 833 CDS 100% 13.200 10.560 N GGA3 n/a
5 TRCN0000257080 GAGAACAAGAGGCGGACTTTA pLKO_005 954 CDS 100% 13.200 9.240 N GGA3 n/a
6 TRCN0000232889 ACTATGGGAAGAGGTCATATC pLKO_005 3704 3UTR 100% 10.800 7.560 N GGA3 n/a
7 TRCN0000232886 ATGGCGAGGTGGCTACCTTAA pLKO_005 1096 CDS 100% 10.800 7.560 N GGA3 n/a
8 TRCN0000065021 CCAGAAGAAGCAAAGATCAAA pLKO.1 564 CDS 100% 5.625 3.938 N GGA3 n/a
9 TRCN0000065022 GCCCAAGTCAATGAAAGTGAA pLKO.1 2132 CDS 100% 4.950 3.465 N GGA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.