Transcript: Human NM_001293642.1

Homo sapiens carbonic anhydrase 12 (CA12), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CA12 (771)
Length:
3996
CDS:
391..1242

Additional Resources:

NCBI RefSeq record:
NM_001293642.1
NBCI Gene record:
CA12 (771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293642.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116248 CCATTATAACTCAGACCTTTA pLKO.1 651 CDS 100% 10.800 15.120 N CA12 n/a
2 TRCN0000303910 TTCGATGAGAGGCTGGTATAC pLKO_005 1048 CDS 100% 10.800 15.120 N CA12 n/a
3 TRCN0000116247 GCCATAATGTAAGGACAGAAT pLKO.1 2035 3UTR 100% 4.950 6.930 N CA12 n/a
4 TRCN0000331236 ACGGTTCCAAGTGGACTTATT pLKO_005 473 CDS 100% 13.200 10.560 N CA12 n/a
5 TRCN0000116249 GTGATAACAAGGGAGTCATTT pLKO.1 1181 CDS 100% 13.200 9.240 N CA12 n/a
6 TRCN0000300285 GTGATAACAAGGGAGTCATTT pLKO_005 1181 CDS 100% 13.200 9.240 N CA12 n/a
7 TRCN0000116250 GTCCCGGGATTCAACATTGAA pLKO.1 814 CDS 100% 5.625 3.938 N CA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293642.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.