Transcript: Mouse NM_001293769.1

Mus musculus microfibrillar-associated protein 3-like (Mfap3l), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mfap3l (71306)
Length:
5942
CDS:
246..1166

Additional Resources:

NCBI RefSeq record:
NM_001293769.1
NBCI Gene record:
Mfap3l (71306)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293769.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089645 CTAACATCTATGGCACTATAA pLKO.1 319 CDS 100% 13.200 18.480 N Mfap3l n/a
2 TRCN0000089643 CCGTTCTTTCCTAATGGAGTA pLKO.1 1619 3UTR 100% 4.050 5.670 N Mfap3l n/a
3 TRCN0000417571 GACTCGGATGCTTCGTCATTG pLKO_005 840 CDS 100% 10.800 8.640 N Mfap3l n/a
4 TRCN0000418138 AGACATGGGCGTGTACTATAT pLKO_005 377 CDS 100% 13.200 9.240 N Mfap3l n/a
5 TRCN0000089647 TCTTTCTCAGACAGAGGTAAA pLKO.1 282 CDS 100% 10.800 7.560 N Mfap3l n/a
6 TRCN0000417762 TGGAATTTGCTAGGTACATTG pLKO_005 619 CDS 100% 10.800 7.560 N Mfap3l n/a
7 TRCN0000089646 CAGAACCATCAGAGGAACATT pLKO.1 973 CDS 100% 5.625 3.938 N Mfap3l n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3984 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293769.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.