Transcript: Human NM_001297553.2

Homo sapiens chromodomain helicase DNA binding protein 4 (CHD4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CHD4 (1108)
Length:
6390
CDS:
79..5796

Additional Resources:

NCBI RefSeq record:
NM_001297553.2
NBCI Gene record:
CHD4 (1108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021363 GCGGGAGTTCAGTACCAATAA pLKO.1 684 CDS 100% 13.200 18.480 N CHD4 n/a
2 TRCN0000319288 GCGGGAGTTCAGTACCAATAA pLKO_005 684 CDS 100% 13.200 18.480 N CHD4 n/a
3 TRCN0000021360 CGAAGGTTTAAGCTCTTAGAA pLKO.1 5407 CDS 100% 5.625 7.875 N CHD4 n/a
4 TRCN0000349610 CGAAGGTTTAAGCTCTTAGAA pLKO_005 5407 CDS 100% 5.625 7.875 N CHD4 n/a
5 TRCN0000086145 CCTGCGGAATGATAAAGATAA pLKO.1 4230 CDS 100% 13.200 9.240 N Chd4 n/a
6 TRCN0000021359 CCTTACTAGAATTGGTGTTAT pLKO.1 4533 CDS 100% 13.200 9.240 N CHD4 n/a
7 TRCN0000319290 CCTTACTAGAATTGGTGTTAT pLKO_005 4533 CDS 100% 13.200 9.240 N CHD4 n/a
8 TRCN0000086144 GCCTGCGGAATGATAAAGATA pLKO.1 4229 CDS 100% 5.625 3.938 N Chd4 n/a
9 TRCN0000380822 GCTACCTCTGTTGGCATCTTT pLKO_005 6225 3UTR 100% 5.625 3.938 N CHD4 n/a
10 TRCN0000021362 GCTGACACAGTTATTATCTAT pLKO.1 3469 CDS 100% 5.625 3.938 N CHD4 n/a
11 TRCN0000380981 TTCCTGCCAGGCTTGAAGAAA pLKO_005 6093 3UTR 100% 5.625 3.938 N CHD4 n/a
12 TRCN0000380166 GCCTGTTACACACAAACTGTT pLKO_005 6067 3UTR 100% 4.950 3.465 N CHD4 n/a
13 TRCN0000021361 GCTGCTGACATCCTATGAATT pLKO.1 2598 CDS 100% 0.000 0.000 N CHD4 n/a
14 TRCN0000319289 GCTGCTGACATCCTATGAATT pLKO_005 2598 CDS 100% 0.000 0.000 N CHD4 n/a
15 TRCN0000381507 GCCCATCTTCCATGTTGTAAA pLKO_005 5900 3UTR 100% 13.200 7.920 N CHD4 n/a
16 TRCN0000160007 CAAGAAGAAGAAGAAGAAGTA pLKO.1 396 CDS 100% 4.950 2.475 Y FAM98C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.