Transcript: Human NM_001297756.1

Homo sapiens helicase, POLQ like (HELQ), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-15
Taxon:
Homo sapiens (human)
Gene:
HELQ (113510)
Length:
3636
CDS:
1695..3509

Additional Resources:

NCBI RefSeq record:
NM_001297756.1
NBCI Gene record:
HELQ (113510)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434179 ACGTTGTCAACAGGCTATATC pLKO_005 2992 CDS 100% 13.200 18.480 N HELQ n/a
2 TRCN0000421485 CGTAAGGACAATTGATCATTT pLKO_005 3341 CDS 100% 13.200 18.480 N HELQ n/a
3 TRCN0000051561 CCCTGATTGGATGATATACTT pLKO.1 2852 CDS 100% 5.625 7.875 N HELQ n/a
4 TRCN0000051562 GCAACCTTACTGAATTACAAA pLKO.1 678 5UTR 100% 5.625 7.875 N HELQ n/a
5 TRCN0000422048 ATTGGTATGAGTGCAACATTA pLKO_005 1670 5UTR 100% 13.200 9.240 N HELQ n/a
6 TRCN0000051559 GCAGAACTCTTCAAATGATTT pLKO.1 808 5UTR 100% 13.200 9.240 N HELQ n/a
7 TRCN0000424253 GGATATGAAGGTGTCACTATT pLKO_005 725 5UTR 100% 13.200 9.240 N HELQ n/a
8 TRCN0000417123 TCTTGATGACATCTATCATTT pLKO_005 2510 CDS 100% 13.200 9.240 N HELQ n/a
9 TRCN0000421264 TGCTCAAAGAGACCAACATTT pLKO_005 3034 CDS 100% 13.200 9.240 N HELQ n/a
10 TRCN0000435551 AGTCTAATGCACTTAGCTAAT pLKO_005 3303 CDS 100% 10.800 7.560 N HELQ n/a
11 TRCN0000426342 TTGGTGACTATGATAGCTTTA pLKO_005 513 5UTR 100% 10.800 7.560 N HELQ n/a
12 TRCN0000051560 CCTAGTAAGAAGAACTGTGAA pLKO.1 1956 CDS 100% 4.950 3.465 N HELQ n/a
13 TRCN0000051558 GCAAATTGTTTCATCAGCAAA pLKO.1 3380 CDS 100% 4.950 3.465 N HELQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.