Transcript: Human NM_001300866.3

Homo sapiens filamin A interacting protein 1 (FILIP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
FILIP1 (27145)
Length:
7978
CDS:
394..3927

Additional Resources:

NCBI RefSeq record:
NM_001300866.3
NBCI Gene record:
FILIP1 (27145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137560 CTGACCAAAGAGTTGGAGCTT pLKO.1 2707 CDS 100% 2.640 3.696 N FILIP1 n/a
2 TRCN0000418599 AGAGAAGATTCACGAATTAAT pLKO_005 2577 CDS 100% 15.000 10.500 N FILIP1 n/a
3 TRCN0000137379 GCTGGTGGATGAAAGACAAAT pLKO.1 1140 CDS 100% 13.200 9.240 N FILIP1 n/a
4 TRCN0000138494 CCACATGCTGAAGACAGAGAA pLKO.1 687 CDS 100% 4.950 3.465 N FILIP1 n/a
5 TRCN0000137207 GCTCAGACTTGAAGTTGAGAA pLKO.1 1653 CDS 100% 4.950 3.465 N FILIP1 n/a
6 TRCN0000135617 GTACGGAAATACAACTCCAAT pLKO.1 3541 CDS 100% 4.950 3.465 N FILIP1 n/a
7 TRCN0000136047 GATGTCTATGAGAAACCGATT pLKO.1 817 CDS 100% 4.050 2.835 N FILIP1 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4853 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.