Transcript: Human NM_001300911.2

Homo sapiens myotilin (MYOT), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MYOT (9499)
Length:
1917
CDS:
300..1451

Additional Resources:

NCBI RefSeq record:
NM_001300911.2
NBCI Gene record:
MYOT (9499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426333 TTACGGGTTCGACCAACATTC pLKO_005 1314 CDS 100% 10.800 15.120 N MYOT n/a
2 TRCN0000083582 CACAAGTAAGAAGTAGATCAA pLKO.1 628 CDS 100% 4.950 3.960 N MYOT n/a
3 TRCN0000083581 GCACGTCCAAACCAAACTCTT pLKO.1 1278 CDS 100% 4.950 3.960 N MYOT n/a
4 TRCN0000422359 AGCTTCCTCAGCTCCATATTA pLKO_005 237 5UTR 100% 15.000 10.500 N MYOT n/a
5 TRCN0000083579 CCTGATTACAATAGCAGTAAA pLKO.1 267 5UTR 100% 13.200 9.240 N MYOT n/a
6 TRCN0000426942 TGATGTGTCATGGTATCTAAA pLKO_005 791 CDS 100% 13.200 9.240 N MYOT n/a
7 TRCN0000083580 GCACCAATGTTTATCTACAAA pLKO.1 996 CDS 100% 5.625 3.938 N MYOT n/a
8 TRCN0000083578 GCCTACAGGAAATCTGGGTAT pLKO.1 1640 3UTR 100% 4.050 2.835 N MYOT n/a
9 TRCN0000416649 GGAAATCAACGTCTAACATAT pLKO_005 477 CDS 100% 13.200 7.920 N MYOT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.