Transcript: Human NM_001300926.1

Homo sapiens ring finger protein 121 (RNF121), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
RNF121 (55298)
Length:
2461
CDS:
399..1016

Additional Resources:

NCBI RefSeq record:
NM_001300926.1
NBCI Gene record:
RNF121 (55298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424542 AGCTAACGTACTCAGGCTTGT pLKO_005 1613 3UTR 100% 4.050 5.670 N RNF121 n/a
2 TRCN0000435683 GTGGTTCCTGCTAATCTATAA pLKO_005 713 CDS 100% 13.200 9.240 N RNF121 n/a
3 TRCN0000366929 GTTTACCCTCTTTGGTCTTAA pLKO_005 776 CDS 100% 13.200 9.240 N Rnf121 n/a
4 TRCN0000417306 AGAGGCCTCACGTCATGTATG pLKO_005 1047 3UTR 100% 10.800 7.560 N RNF121 n/a
5 TRCN0000434015 AGCCTGGTGCACTTAGTATAG pLKO_005 1589 3UTR 100% 10.800 7.560 N RNF121 n/a
6 TRCN0000007723 CCTAGTGATCTGGATCTTGTT pLKO.1 614 CDS 100% 4.950 3.465 N RNF121 n/a
7 TRCN0000007722 GCTGTCATGTTTACCCTCTTT pLKO.1 768 CDS 100% 4.950 3.465 N RNF121 n/a
8 TRCN0000007724 CAGCCTGTCATCATTGGTGTA pLKO.1 1106 3UTR 100% 4.050 2.835 N RNF121 n/a
9 TRCN0000419290 GAGTTCTGGAACGGGACTTTG pLKO_005 871 CDS 100% 10.800 6.480 N RNF121 n/a
10 TRCN0000375751 TCTTCTATGGCCTCTACTATG pLKO_005 850 CDS 100% 10.800 6.480 N Rnf121 n/a
11 TRCN0000432148 TGCTGTCACAGCCTTTGTTAC pLKO_005 638 CDS 100% 10.800 6.480 N RNF121 n/a
12 TRCN0000007721 GCCTCAGAATTCATTGAAGAT pLKO.1 1796 3UTR 100% 0.000 0.000 N RNF121 n/a
13 TRCN0000007725 CATGGCATCTACCATAGGGTT pLKO.1 911 CDS 100% 2.640 3.696 N RNF121 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.