Transcript: Mouse NM_001301335.1

Mus musculus casein alpha s2-like B (Csn1s2b), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Csn1s2b (12992)
Length:
733
CDS:
58..456

Additional Resources:

NCBI RefSeq record:
NM_001301335.1
NBCI Gene record:
Csn1s2b (12992)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247359 TACTTCTCATTACCAACATAT pLKO_005 496 3UTR 100% 13.200 18.480 N Csn1s2b n/a
2 TRCN0000247360 GAAGCTCCCATGAAGGTATCT pLKO_005 211 CDS 100% 4.950 6.930 N Csn1s2b n/a
3 TRCN0000247358 TGTAAAGCTTCTCCATCAATA pLKO_005 381 CDS 100% 13.200 10.560 N Csn1s2b n/a
4 TRCN0000216232 CATCATTTCTCAGCAACAATA pLKO.1 234 CDS 100% 13.200 9.240 N Csn1s2b n/a
5 TRCN0000257644 CATCATTTCTCAGCAACAATA pLKO_005 234 CDS 100% 13.200 9.240 N Csn1s2b n/a
6 TRCN0000247357 AGTGAGGAGTCCATGGATAAC pLKO_005 130 CDS 100% 10.800 7.560 N Csn1s2b n/a
7 TRCN0000216340 GTAAGAACATCCAAGACTACA pLKO.1 317 CDS 100% 4.950 3.465 N Csn1s2b n/a
8 TRCN0000191386 CATTACCAACATATTGGGATA pLKO.1 503 3UTR 100% 4.050 2.835 N Csn1s2b n/a
9 TRCN0000201715 GCAGAATATGGATGTGGCCTT pLKO.1 168 CDS 100% 2.160 1.512 N Csn1s2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.