Transcript: Mouse NM_001301364.1

Mus musculus high density lipoprotein (HDL) binding protein (Hdlbp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hdlbp (110611)
Length:
6282
CDS:
225..4031

Additional Resources:

NCBI RefSeq record:
NM_001301364.1
NBCI Gene record:
Hdlbp (110611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105174 CGGAGCCAACATCAACAGAAT pLKO.1 1586 CDS 100% 4.950 6.930 N Hdlbp n/a
2 TRCN0000325803 CGGAGCCAACATCAACAGAAT pLKO_005 1586 CDS 100% 4.950 6.930 N Hdlbp n/a
3 TRCN0000154197 CCATCGCTTTGTTATTGGCAA pLKO.1 707 CDS 100% 2.640 3.696 N HDLBP n/a
4 TRCN0000306050 ATGGTCAAAGACCTGATTAAT pLKO_005 1503 CDS 100% 15.000 10.500 N Hdlbp n/a
5 TRCN0000306116 GCAGCTGGACCCTCGTAAATT pLKO_005 4103 3UTR 100% 15.000 10.500 N Hdlbp n/a
6 TRCN0000105171 GCTCGCATTAAGAAGATTTAT pLKO.1 1068 CDS 100% 15.000 10.500 N Hdlbp n/a
7 TRCN0000325804 GCTCGCATTAAGAAGATTTAT pLKO_005 1068 CDS 100% 15.000 10.500 N Hdlbp n/a
8 TRCN0000105172 CCAGAGGTTATCATCAACTTT pLKO.1 1836 CDS 100% 5.625 3.938 N Hdlbp n/a
9 TRCN0000325879 CCAGAGGTTATCATCAACTTT pLKO_005 1836 CDS 100% 5.625 3.938 N Hdlbp n/a
10 TRCN0000105173 CCTTAAATTCAGAAGAGGAAA pLKO.1 307 CDS 100% 4.950 3.465 N Hdlbp n/a
11 TRCN0000154928 GCCAAGCCAGAATACCACAAA pLKO.1 2424 CDS 100% 4.950 3.465 N HDLBP n/a
12 TRCN0000292469 GCCAAGCCAGAATACCACAAA pLKO_005 2424 CDS 100% 4.950 3.465 N HDLBP n/a
13 TRCN0000105170 CCCATTTAATAACTCAGGCTT pLKO.1 5559 3UTR 100% 2.640 1.848 N Hdlbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.