Transcript: Mouse NM_001301373.1

Mus musculus follistatin (Fst), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Fst (14313)
Length:
2575
CDS:
366..1400

Additional Resources:

NCBI RefSeq record:
NM_001301373.1
NBCI Gene record:
Fst (14313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301373.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066258 CCCAACTGCATCCCTTGTAAA pLKO.1 621 CDS 100% 13.200 9.240 N Fst n/a
2 TRCN0000058321 GCCTACTGTGTGACCTGTAAT pLKO.1 924 CDS 100% 13.200 9.240 N FST n/a
3 TRCN0000305052 GGCATGGAGAGATGGTCATTT pLKO_005 1633 3UTR 100% 13.200 9.240 N Fst n/a
4 TRCN0000066261 GCAACTCCATCTCGGAAGAAA pLKO.1 1312 CDS 100% 5.625 3.938 N Fst n/a
5 TRCN0000303229 GCAACTCCATCTCGGAAGAAA pLKO_005 1312 CDS 100% 5.625 3.938 N Fst n/a
6 TRCN0000066260 TGTCGAATGAACAAGAAGAAT pLKO.1 681 CDS 100% 5.625 3.938 N Fst n/a
7 TRCN0000303155 TGTCGAATGAACAAGAAGAAT pLKO_005 681 CDS 100% 5.625 3.938 N Fst n/a
8 TRCN0000066259 CAGGTCCTGTATAAGACAGAA pLKO.1 492 CDS 100% 4.950 3.465 N Fst n/a
9 TRCN0000066262 GAGGAGGATGTGAACGACAAT pLKO.1 564 CDS 100% 4.950 3.465 N Fst n/a
10 TRCN0000303157 GAGGAGGATGTGAACGACAAT pLKO_005 564 CDS 100% 4.950 3.465 N Fst n/a
11 TRCN0000379257 TCTCCCAGGCCACGTTGTTAT pLKO_005 1606 3UTR 100% 13.200 7.920 N Fst n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301373.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.