Transcript: Mouse NM_001302163.1

Mus musculus acyl-CoA synthetase long-chain family member 1 (Acsl1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Acsl1 (14081)
Length:
3927
CDS:
229..2328

Additional Resources:

NCBI RefSeq record:
NM_001302163.1
NBCI Gene record:
Acsl1 (14081)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076069 CCGAAGATCTTGCGATAATTT pLKO.1 1031 CDS 100% 15.000 21.000 N Acsl1 n/a
2 TRCN0000334704 CCGAAGATCTTGCGATAATTT pLKO_005 1031 CDS 100% 15.000 21.000 N Acsl1 n/a
3 TRCN0000076072 CGACTTGTTGAAACTTGGGAA pLKO.1 2139 CDS 100% 2.640 3.696 N Acsl1 n/a
4 TRCN0000334706 CGACTTGTTGAAACTTGGGAA pLKO_005 2139 CDS 100% 2.640 3.696 N Acsl1 n/a
5 TRCN0000222618 CCTGTGGGATAAACTCATCTT pLKO.1 1461 CDS 100% 4.950 3.465 N Acsl1 n/a
6 TRCN0000334630 CCTGTGGGATAAACTCATCTT pLKO_005 1461 CDS 100% 4.950 3.465 N Acsl1 n/a
7 TRCN0000076071 GCTGATTGACATTCGGCAGTA pLKO.1 270 CDS 100% 4.050 2.835 N Acsl1 n/a
8 TRCN0000334629 GCTGATTGACATTCGGCAGTA pLKO_005 270 CDS 100% 4.050 2.835 N Acsl1 n/a
9 TRCN0000076068 CCCTTTAAGAACAACTGTCCA pLKO.1 2763 3UTR 100% 2.640 1.848 N Acsl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.