Transcript: Mouse NM_001302469.1

Mus musculus stromal cell derived factor 4 (Sdf4), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sdf4 (20318)
Length:
990
CDS:
190..846

Additional Resources:

NCBI RefSeq record:
NM_001302469.1
NBCI Gene record:
Sdf4 (20318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114823 CACCTCAACAAGGACTTCCAT pLKO.1 400 CDS 100% 3.000 2.100 N Sdf4 n/a
2 TRCN0000350127 CACCTCAACAAGGACTTCCAT pLKO_005 400 CDS 100% 3.000 2.100 N Sdf4 n/a
3 TRCN0000056057 CCGGAGGAAGCTGATGGTCAT pLKO.1 483 CDS 100% 1.350 0.945 N SDF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.