Transcript: Human NM_001302809.1

Homo sapiens chromosome 17 open reading frame 77 (C17orf77), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
C17orf77 (146723)
Length:
2689
CDS:
527..1258

Additional Resources:

NCBI RefSeq record:
NM_001302809.1
NBCI Gene record:
C17orf77 (146723)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172645 GAATCCAAGCTCGGAAGTCAA pLKO.1 742 CDS 100% 4.950 6.930 N C17orf77 n/a
2 TRCN0000371446 TCCAATCCTTGGATCAAATAT pLKO_005 1616 3UTR 100% 15.000 10.500 N C17orf77 n/a
3 TRCN0000371392 CCCTCCTGAATCGATTCATTT pLKO_005 1502 3UTR 100% 13.200 9.240 N C17orf77 n/a
4 TRCN0000371451 CCACTGTAAGACATCTCATTG pLKO_005 1170 CDS 100% 10.800 7.560 N C17orf77 n/a
5 TRCN0000172793 GCTGTCATTCCAGTGCCTTAA pLKO.1 604 CDS 100% 10.800 7.560 N C17orf77 n/a
6 TRCN0000168539 CTTGCTCACTTCCTGTTACAT pLKO.1 796 CDS 100% 5.625 3.938 N C17orf77 n/a
7 TRCN0000167249 CATCTGTAGCTACTTCTCTTT pLKO.1 814 CDS 100% 4.950 3.465 N C17orf77 n/a
8 TRCN0000172792 GACATGTCTCCTTCCTGAGAA pLKO.1 556 CDS 100% 4.950 3.465 N C17orf77 n/a
9 TRCN0000172620 GTCTCTTGCTCACTTCCTGTT pLKO.1 792 CDS 100% 4.050 2.835 N C17orf77 n/a
10 TRCN0000172670 GACTTGAATCCAAGCTCGGAA pLKO.1 737 CDS 100% 2.640 1.848 N C17orf77 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.