Transcript: Mouse NM_001302956.1

Mus musculus quiescin Q6 sulfhydryl oxidase 2 (Qsox2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Qsox2 (227638)
Length:
3914
CDS:
48..2126

Additional Resources:

NCBI RefSeq record:
NM_001302956.1
NBCI Gene record:
Qsox2 (227638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198292 GCCTGCCATGAGGAAATTAAA pLKO.1 1641 CDS 100% 15.000 10.500 N Qsox2 n/a
2 TRCN0000198420 GCTTGAGAATTGGGCCTATTT pLKO.1 3425 3UTR 100% 13.200 9.240 N Qsox2 n/a
3 TRCN0000177511 CTGTTACTTGATTTACCCAAA pLKO.1 806 CDS 100% 4.050 2.835 N Qsox2 n/a
4 TRCN0000182251 CCGCACATATGACATCCACTT pLKO.1 422 CDS 100% 0.000 0.000 N Qsox2 n/a
5 TRCN0000197578 CCTGGACAAGATTCCATATAA pLKO.1 1184 CDS 100% 15.000 9.000 N Qsox2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.