Transcript: Human NM_001303096.1

Homo sapiens WD repeat domain 75 (WDR75), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
WDR75 (84128)
Length:
2750
CDS:
287..2587

Additional Resources:

NCBI RefSeq record:
NM_001303096.1
NBCI Gene record:
WDR75 (84128)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152085 CCGATCCTAATTCAGAGAATA pLKO.1 1857 CDS 100% 13.200 18.480 N WDR75 n/a
2 TRCN0000151800 CCAGATATATTTCAGCTGGTT pLKO.1 464 CDS 100% 2.640 3.696 N WDR75 n/a
3 TRCN0000427123 CCGCGTTTAGGAGCTACTATT pLKO_005 953 CDS 100% 13.200 10.560 N WDR75 n/a
4 TRCN0000150523 GATGGTTCTTTACTAGCAGTT pLKO.1 1619 CDS 100% 4.050 3.240 N WDR75 n/a
5 TRCN0000423045 TTCCCTTGATGGCACAATTAA pLKO_005 322 CDS 100% 15.000 10.500 N WDR75 n/a
6 TRCN0000156084 CCTGAATCCTTCACCTCAGAA pLKO.1 2012 CDS 100% 4.950 3.465 N WDR75 n/a
7 TRCN0000151116 GCTAAGGAAATTCCTGAAGAT pLKO.1 2384 CDS 100% 4.950 3.465 N WDR75 n/a
8 TRCN0000156055 CCAACAAGCAAACAGCTGCTA pLKO.1 2129 CDS 100% 2.640 1.848 N WDR75 n/a
9 TRCN0000415603 TCTCGCCTGCAGGAGATTTAT pLKO_005 987 CDS 100% 15.000 9.000 N WDR75 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.