Transcript: Mouse NM_001303244.1

Mus musculus interleukin 12b (Il12b), mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Il12b (16160)
Length:
2505
CDS:
57..1064

Additional Resources:

NCBI RefSeq record:
NM_001303244.1
NBCI Gene record:
Il12b (16160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001303244.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422118 TTCGAATCCAGCGCAAGAAAG pLKO_005 871 CDS 100% 10.800 15.120 N Il12b n/a
2 TRCN0000066570 GCACGGCAGCAGAATAAATAT pLKO.1 690 CDS 100% 15.000 10.500 N Il12b n/a
3 TRCN0000435277 AGCTAATGTATGCATAGATAT pLKO_005 1246 3UTR 100% 13.200 9.240 N Il12b n/a
4 TRCN0000066568 CCAGGCCCTATTATGCAAATT pLKO.1 1402 3UTR 100% 13.200 9.240 N Il12b n/a
5 TRCN0000412304 GCAAGCTCAGGATCGCTATTA pLKO_005 992 CDS 100% 13.200 9.240 N Il12b n/a
6 TRCN0000425572 GTAAAGACATAGGTGGTATTT pLKO_005 1542 3UTR 100% 13.200 9.240 N Il12b n/a
7 TRCN0000066571 CTGGAGAAAGACGTTTATGTT pLKO.1 132 CDS 100% 5.625 3.938 N Il12b n/a
8 TRCN0000066572 CCTGAAGTGTGAAGCACCAAA pLKO.1 431 CDS 100% 4.950 3.465 N Il12b n/a
9 TRCN0000066569 CCATTCCTACTTCTCCCTCAA pLKO.1 842 CDS 100% 4.050 2.835 N Il12b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303244.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.