Transcript: Human NM_001303255.2

Homo sapiens leucine rich repeat containing 37 member A3 (LRRC37A3), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
LRRC37A3 (374819)
Length:
2790
CDS:
67..2325

Additional Resources:

NCBI RefSeq record:
NM_001303255.2
NBCI Gene record:
LRRC37A3 (374819)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183215 GCGTTAATTGTGACTGGAATA pLKO.1 2173 CDS 100% 10.800 7.560 N LRRC37A3 n/a
2 TRCN0000254451 AGACTTAACCCACGCTATTTC pLKO_005 1239 CDS 100% 13.200 6.600 Y LRRC37A2 n/a
3 TRCN0000167461 GATGTGAAATCACTGTTACTA pLKO.1 817 CDS 100% 5.625 2.813 Y LRRC37A2 n/a
4 TRCN0000179998 CCAATGGAAGACTGAGAACTA pLKO.1 2052 CDS 100% 4.950 2.475 Y LRRC37A3 n/a
5 TRCN0000145536 CGAAGGTCATTACAAGAAGAT pLKO.1 2242 CDS 100% 4.950 2.475 Y LRRC37A n/a
6 TRCN0000144231 CATCCAAGATAGAATGGGATA pLKO.1 2027 CDS 100% 4.050 2.025 Y LRRC37A n/a
7 TRCN0000143717 GAAAGACTTAACCCACGCTAT pLKO.1 1236 CDS 100% 4.050 2.025 Y LRRC37A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.