Transcript: Human NM_001303265.2

Homo sapiens mitochondrial ribosomal protein L58 (MRPL58), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MRPL58 (3396)
Length:
889
CDS:
18..707

Additional Resources:

NCBI RefSeq record:
NM_001303265.2
NBCI Gene record:
MRPL58 (3396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159873 GATCGCTTGACAATATCTTAT pLKO.1 240 CDS 100% 13.200 18.480 N MRPL58 n/a
2 TRCN0000164232 CCCTCTAGATCGCTTGACAAT pLKO.1 233 CDS 100% 4.950 6.930 N MRPL58 n/a
3 TRCN0000158636 CAATATCTTATTGTCGGAGTA pLKO.1 250 CDS 100% 4.050 5.670 N MRPL58 n/a
4 TRCN0000159589 GCTGTTAATGCTTGTCTATAA pLKO.1 731 3UTR 100% 13.200 9.240 N MRPL58 n/a
5 TRCN0000160123 CACCATAAGGAGATTTCTGTT pLKO.1 700 CDS 100% 4.950 3.465 N MRPL58 n/a
6 TRCN0000161097 GATCAACAGGTTAGGAGAGTT pLKO.1 395 CDS 100% 4.950 3.465 N MRPL58 n/a
7 TRCN0000159769 GCAGAATGTGAACAAAGTGAA pLKO.1 284 CDS 100% 4.950 3.465 N MRPL58 n/a
8 TRCN0000164397 CAGAAGATAGCCATCACGCAT pLKO.1 366 CDS 100% 2.640 1.848 N MRPL58 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.