Transcript: Human NM_001303486.2

Homo sapiens poly(ADP-ribose) glycohydrolase (PARG), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PARG (8505)
Length:
3882
CDS:
119..2803

Additional Resources:

NCBI RefSeq record:
NM_001303486.2
NBCI Gene record:
PARG (8505)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051305 GCTGAGCGAGATGTGGTTTAT pLKO.1 2549 CDS 100% 13.200 9.240 N PARG n/a
2 TRCN0000051304 GCAGTTTAGTAATGCTAACAT pLKO.1 412 CDS 100% 5.625 3.938 N PARG n/a
3 TRCN0000050799 GCGGTGAAGTTAGATTACATT pLKO.1 954 CDS 100% 5.625 3.938 N PARG n/a
4 TRCN0000050801 CCTCAAACAGTAACCCTGGTA pLKO.1 386 CDS 100% 2.640 1.848 N PARG n/a
5 TRCN0000051307 GCCTAGGAAATTCTCCTCCAT pLKO.1 732 CDS 100% 2.640 1.848 N PARG n/a
6 TRCN0000051303 GCTAAGATGAAATCGGAGTAT pLKO.1 1811 CDS 100% 4.950 2.970 N PARG n/a
7 TRCN0000050802 AGGAACAGATTGCCAGTCTTT pLKO.1 1752 CDS 100% 4.950 2.475 Y PARG n/a
8 TRCN0000050800 CCAAACATCAAAGAACAGAAA pLKO.1 1161 CDS 100% 4.950 2.475 Y PARG n/a
9 TRCN0000051306 CGATTGCATGTCACTTACGAA pLKO.1 2021 CDS 100% 3.000 1.500 Y PARG n/a
10 TRCN0000126561 CCATTCATATACCATGCTGTT pLKO.1 2732 CDS 100% 4.050 2.430 N Parg n/a
11 TRCN0000312193 CCATTCATATACCATGCTGTT pLKO_005 2732 CDS 100% 4.050 2.430 N Parg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.