Transcript: Human NM_001303627.1

Homo sapiens malectin (MLEC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
MLEC (9761)
Length:
6100
CDS:
140..769

Additional Resources:

NCBI RefSeq record:
NM_001303627.1
NBCI Gene record:
MLEC (9761)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061885 CCTGTATCAAACTGAGCGGTA pLKO.1 181 CDS 100% 2.160 3.024 N MLEC n/a
2 TRCN0000061887 GAATATGATGAAGGGTCTAAT pLKO.1 602 CDS 100% 13.200 10.560 N MLEC n/a
3 TRCN0000291386 GAATATGATGAAGGGTCTAAT pLKO_005 602 CDS 100% 13.200 10.560 N MLEC n/a
4 TRCN0000061886 CGTGGTGAAGGACTTGGATAT pLKO.1 334 CDS 100% 10.800 7.560 N MLEC n/a
5 TRCN0000291388 CGTGGTGAAGGACTTGGATAT pLKO_005 334 CDS 100% 10.800 7.560 N MLEC n/a
6 TRCN0000061884 CCGGGATTGGAGAAGAAAGAA pLKO.1 563 CDS 100% 5.625 3.938 N MLEC n/a
7 TRCN0000291391 CCGGGATTGGAGAAGAAAGAA pLKO_005 563 CDS 100% 5.625 3.938 N MLEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.