Transcript: Human NM_001304286.2

Homo sapiens HNF1 homeobox B (HNF1B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
HNF1B (6928)
Length:
2398
CDS:
176..1549

Additional Resources:

NCBI RefSeq record:
NM_001304286.2
NBCI Gene record:
HNF1B (6928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255585 ACAGCCTCTCCCACCATAATC pLKO_005 1356 CDS 100% 13.200 9.240 N HNF1B n/a
2 TRCN0000255583 AGTCAGCACCTTGACGAATAT pLKO_005 1333 CDS 100% 13.200 9.240 N HNF1B n/a
3 TRCN0000255579 TCCAATGGCTGTAAACTATAA pLKO_005 1937 3UTR 100% 13.200 9.240 N HNF1B n/a
4 TRCN0000255577 ATCACTTCCTCCTCAACAATC pLKO_005 1175 CDS 100% 10.800 7.560 N HNF1B n/a
5 TRCN0000255581 CTATGCAGTATTGCCACAATG pLKO_005 1654 3UTR 100% 10.800 7.560 N HNF1B n/a
6 TRCN0000255584 CTCCTCTCACCTGATGGTAAA pLKO_005 1280 CDS 100% 10.800 7.560 N HNF1B n/a
7 TRCN0000255580 TGATGCCCACACACCACTTAC pLKO_005 1455 CDS 100% 10.800 7.560 N HNF1B n/a
8 TRCN0000017508 CCGTACTGTCTATGTTGTGAT pLKO.1 1752 3UTR 100% 4.950 3.465 N HNF1B n/a
9 TRCN0000017510 GCAAATCTTGTACCAGGCCTA pLKO.1 826 CDS 100% 2.160 1.512 N HNF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.