Transcript: Human NM_001304438.2

Homo sapiens transmembrane protein 132E (TMEM132E), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TMEM132E (124842)
Length:
5806
CDS:
1496..4720

Additional Resources:

NCBI RefSeq record:
NM_001304438.2
NBCI Gene record:
TMEM132E (124842)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417150 TCTACAGCCCACGAGACTATG pLKO_005 3723 CDS 100% 10.800 15.120 N TMEM132E n/a
2 TRCN0000418547 GCAGCTGTGACTACGTGTTTG pLKO_005 2985 CDS 100% 10.800 7.560 N TMEM132E n/a
3 TRCN0000166715 CCATGGACACAGAGATCATCA pLKO.1 2829 CDS 100% 4.950 3.465 N TMEM132E n/a
4 TRCN0000162827 CGAGTCTGACAATGAAGACAT pLKO.1 2950 CDS 100% 4.950 3.465 N TMEM132E n/a
5 TRCN0000163863 CTGCACAAAGACTTTCCTCAA pLKO.1 5152 3UTR 100% 4.050 2.835 N TMEM132E n/a
6 TRCN0000163298 GCTGGACTTTGAAATGGAGAA pLKO.1 2671 CDS 100% 4.050 2.835 N TMEM132E n/a
7 TRCN0000434914 CCATCCCTGTCAAGGTCATTG pLKO_005 2880 CDS 100% 10.800 6.480 N TMEM132E n/a
8 TRCN0000166193 CGTCTTCCTCATCAACTGCAT pLKO.1 4204 CDS 100% 2.640 1.584 N TMEM132E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.