Transcript: Human NM_001304523.2

Homo sapiens mitotic arrest deficient 1 like 1 (MAD1L1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MAD1L1 (8379)
Length:
2516
CDS:
85..2241

Additional Resources:

NCBI RefSeq record:
NM_001304523.2
NBCI Gene record:
MAD1L1 (8379)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244894 GACCACGAGCAGCAGATTAAG pLKO_005 742 CDS 100% 13.200 18.480 N MAD1L1 n/a
2 TRCN0000006560 CCTGAGATCTTTGAACAACTT pLKO.1 123 CDS 100% 4.950 3.960 N MAD1L1 n/a
3 TRCN0000006561 AGCGATTGTGAAGAACATGAA pLKO.1 801 CDS 100% 4.950 3.465 N MAD1L1 n/a
4 TRCN0000006563 CCAGAAACAAAGAGCAGACAT pLKO.1 1479 CDS 100% 4.950 3.465 N MAD1L1 n/a
5 TRCN0000244893 CGAGACCATCAACGCACTGAA pLKO_005 552 CDS 100% 4.950 3.465 N MAD1L1 n/a
6 TRCN0000006559 GCTTGCCTTGAAGGACAAGAA pLKO.1 1119 CDS 100% 4.950 3.465 N MAD1L1 n/a
7 TRCN0000006562 CCGTTCGAAGTCCCACCTCAT pLKO.1 258 CDS 100% 1.350 0.945 N MAD1L1 n/a
8 TRCN0000244891 AGGCTCTGGACTGGATATTTC pLKO_005 165 CDS 100% 13.200 7.920 N MAD1L1 n/a
9 TRCN0000244892 AGCAAGAGGCTGCGTGAGAAA pLKO_005 508 CDS 100% 4.950 2.970 N MAD1L1 n/a
10 TRCN0000257291 ATGCCAGGAAGCCAATCAGAA pLKO_005 684 CDS 100% 4.950 2.970 N MAD1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.