Transcript: Mouse NM_001304719.1

Mus musculus ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 (Atp5f1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Atp5f1 (11950)
Length:
1808
CDS:
805..1500

Additional Resources:

NCBI RefSeq record:
NM_001304719.1
NBCI Gene record:
Atp5f1 (11950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001304719.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054445 ATTACAGGCAACAAGGGCCTT pLKO.1 810 CDS 100% 2.160 1.512 N Atp5f1 n/a
2 TRCN0000054444 TCTTCCTGAATATGGAGGAAA pLKO.1 867 CDS 100% 0.495 0.347 N Atp5f1 n/a
3 TRCN0000054447 GCCTTTCACACAGGACAGCCT pLKO.1 826 CDS 100% 0.220 0.154 N Atp5f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304719.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.