Transcript: Mouse NM_001304784.2

Mus musculus HDGF like 2 (Hdgfl2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Hdgfl2 (15193)
Length:
2322
CDS:
125..2161

Additional Resources:

NCBI RefSeq record:
NM_001304784.2
NBCI Gene record:
Hdgfl2 (15193)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001304784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096653 TGTCAGTCTCTAAACGAGCTA pLKO.1 615 CDS 100% 2.640 3.696 N Hdgfl2 n/a
2 TRCN0000331499 TGTCAGTCTCTAAACGAGCTA pLKO_005 615 CDS 100% 2.640 3.696 N Hdgfl2 n/a
3 TRCN0000096650 CAGTCTCTAAACGAGCTAGAA pLKO.1 618 CDS 100% 4.950 3.960 N Hdgfl2 n/a
4 TRCN0000304390 ACAAGAGGAAAGGCTTCAATG pLKO_005 339 CDS 100% 10.800 7.560 N Hdgfl2 n/a
5 TRCN0000304345 AGTCTGCCAATGATGACAATG pLKO_005 2130 CDS 100% 10.800 7.560 N Hdgfl2 n/a
6 TRCN0000375899 TGAATGGAAGAGACGTGATGA pLKO_005 1105 CDS 100% 4.950 3.465 N Hdgfl2 n/a
7 TRCN0000096649 CTATGATAAGTGCAAGGACAA pLKO.1 304 CDS 100% 4.050 2.835 N Hdgfl2 n/a
8 TRCN0000096651 GCTGAAGAAGATTCGCCGGTA pLKO.1 1705 CDS 100% 2.160 1.512 N Hdgfl2 n/a
9 TRCN0000096652 CTGCAGGTAACCTCTCAGATT pLKO.1 1655 CDS 100% 4.950 2.970 N Hdgfl2 n/a
10 TRCN0000301661 CTGCAGGTAACCTCTCAGATT pLKO_005 1655 CDS 100% 4.950 2.970 N Hdgfl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.