Transcript: Human NM_001304990.1

Homo sapiens sprouty RTK signaling antagonist 3 (SPRY3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
SPRY3 (10251)
Length:
8963
CDS:
365..1231

Additional Resources:

NCBI RefSeq record:
NM_001304990.1
NBCI Gene record:
SPRY3 (10251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056810 CGCTCTACTCATGCTAGCAAT pLKO.1 419 CDS 100% 4.950 3.960 N SPRY3 n/a
2 TRCN0000056808 GCTCATTCATTCCTCACAATT pLKO.1 4505 3UTR 100% 13.200 9.240 N SPRY3 n/a
3 TRCN0000056812 CAACACTGTGTGCAGAAAGAT pLKO.1 1162 CDS 100% 5.625 3.938 N SPRY3 n/a
4 TRCN0000056811 CCACTGATGATGAAGACAACT pLKO.1 960 CDS 100% 4.950 3.465 N SPRY3 n/a
5 TRCN0000056809 GCCCTTCCCTTATTGTGCAAA pLKO.1 486 CDS 100% 4.950 3.465 N SPRY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.