Transcript: Human NM_001305002.1

Homo sapiens integrin alpha FG-GAP repeat containing 1 (ITFG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-09-24
Taxon:
Homo sapiens (human)
Gene:
ITFG1 (81533)
Length:
3078
CDS:
292..1686

Additional Resources:

NCBI RefSeq record:
NM_001305002.1
NBCI Gene record:
ITFG1 (81533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001305002.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155809 CCATACAACGTGCTTGGTTTA pLKO.1 1447 CDS 100% 10.800 15.120 N ITFG1 n/a
2 TRCN0000155593 CCTCGTAAGATAACACCCTTT pLKO.1 1312 CDS 100% 4.050 5.670 N ITFG1 n/a
3 TRCN0000343701 CCTCGTAAGATAACACCCTTT pLKO_005 1312 CDS 100% 4.050 5.670 N ITFG1 n/a
4 TRCN0000151169 GAATGGCTGTTCACTTGATTA pLKO.1 1759 3UTR 100% 13.200 10.560 N ITFG1 n/a
5 TRCN0000343702 GAATGGCTGTTCACTTGATTA pLKO_005 1759 3UTR 100% 13.200 10.560 N ITFG1 n/a
6 TRCN0000156391 CGACATTGAATGCCACCACTA pLKO.1 620 CDS 100% 4.050 2.835 N ITFG1 n/a
7 TRCN0000343700 CGACATTGAATGCCACCACTA pLKO_005 620 CDS 100% 4.050 2.835 N ITFG1 n/a
8 TRCN0000150363 CTTCTGACATATCTTCCCAAA pLKO.1 301 CDS 100% 4.050 2.835 N ITFG1 n/a
9 TRCN0000155354 CCCAGCTAATTGTCATTCCAT pLKO.1 1571 CDS 100% 3.000 2.100 N ITFG1 n/a
10 TRCN0000343775 CCCAGCTAATTGTCATTCCAT pLKO_005 1571 CDS 100% 3.000 2.100 N ITFG1 n/a
11 TRCN0000154889 CCTTCTGACATATCTTCCCAA pLKO.1 300 CDS 100% 2.640 1.848 N ITFG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305002.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.