Transcript: Mouse NM_001305631.1

Mus musculus centromere protein I (Cenpi), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cenpi (102920)
Length:
3624
CDS:
282..2522

Additional Resources:

NCBI RefSeq record:
NM_001305631.1
NBCI Gene record:
Cenpi (102920)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001305631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247507 ATGTACAGGTATCGCAATAAT pLKO_005 2085 CDS 100% 15.000 21.000 N Cenpi n/a
2 TRCN0000247509 TGCTGTAAACTCACGGATATT pLKO_005 641 CDS 100% 13.200 18.480 N Cenpi n/a
3 TRCN0000174853 GAAGAAATGGAACTGGTATTT pLKO.1 2405 CDS 100% 13.200 9.240 N Cenpi n/a
4 TRCN0000247510 TTACTCCTCAGACATACTTAT pLKO_005 2850 3UTR 100% 13.200 9.240 N Cenpi n/a
5 TRCN0000247508 TATTGGTTGAGTCAAGCATTA pLKO_005 1434 CDS 100% 10.800 7.560 N Cenpi n/a
6 TRCN0000175464 CCATGAGTTCTGTGTCTCAAT pLKO.1 1852 CDS 100% 4.950 3.465 N Cenpi n/a
7 TRCN0000175736 GCAGTAGGATACTTCCAGAAA pLKO.1 477 CDS 100% 4.950 3.465 N Cenpi n/a
8 TRCN0000247506 TGACAAGTGTTCTGGTAATAC pLKO_005 731 CDS 100% 13.200 7.920 N Cenpi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.