Transcript: Mouse NM_001305632.1

Mus musculus phospholipase A2, group IVA (cytosolic, calcium-dependent) (Pla2g4a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pla2g4a (18783)
Length:
2866
CDS:
188..2410

Additional Resources:

NCBI RefSeq record:
NM_001305632.1
NBCI Gene record:
Pla2g4a (18783)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001305632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348528 GTTTGATCGGGAAGGATTAAA pLKO_005 1993 CDS 100% 15.000 21.000 N Pla2g4a n/a
2 TRCN0000097274 GCTGGGATGATCAAGCCATTT pLKO.1 2418 3UTR 100% 10.800 7.560 N Pla2g4a n/a
3 TRCN0000335307 GCTGGGATGATCAAGCCATTT pLKO_005 2418 3UTR 100% 10.800 7.560 N Pla2g4a n/a
4 TRCN0000097276 CGGTAGCAGATCCAGATGAAT pLKO.1 1731 CDS 100% 5.625 3.938 N Pla2g4a n/a
5 TRCN0000097275 CCCTGAGTAGTTTGAAGGAAA pLKO.1 1095 CDS 100% 4.950 3.465 N Pla2g4a n/a
6 TRCN0000335306 CCCTGAGTAGTTTGAAGGAAA pLKO_005 1095 CDS 100% 4.950 3.465 N Pla2g4a n/a
7 TRCN0000097277 GCACAGCTACATTCCCTGTAT pLKO.1 471 CDS 100% 4.950 3.465 N Pla2g4a n/a
8 TRCN0000335305 GCACAGCTACATTCCCTGTAT pLKO_005 471 CDS 100% 4.950 3.465 N Pla2g4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.