Transcript: Mouse NM_001306059.1

Mus musculus interleukin 13 receptor, alpha 2 (Il13ra2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Il13ra2 (16165)
Length:
2163
CDS:
985..2004

Additional Resources:

NCBI RefSeq record:
NM_001306059.1
NBCI Gene record:
Il13ra2 (16165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001306059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431114 TTGGACTCATCAGACTATAAA pLKO_005 1570 CDS 100% 15.000 21.000 N Il13ra2 n/a
2 TRCN0000414041 ATATTCTGATACCAACTATAC pLKO_005 1455 CDS 100% 10.800 15.120 N Il13ra2 n/a
3 TRCN0000067804 CCAAGGTGTTACACTTATGAA pLKO.1 1765 CDS 100% 5.625 7.875 N Il13ra2 n/a
4 TRCN0000067806 CCATGGATAGAAGCTTCTTAT pLKO.1 1330 CDS 100% 13.200 9.240 N Il13ra2 n/a
5 TRCN0000067803 CCACCAATTTCTTGACATAGA pLKO.1 2022 3UTR 100% 4.950 3.465 N Il13ra2 n/a
6 TRCN0000067807 GCTGATTACCTCCAGCATGAT pLKO.1 1519 CDS 100% 4.950 3.465 N Il13ra2 n/a
7 TRCN0000067805 GCCACCAGAATTCCTTCATAT pLKO.1 1683 CDS 100% 0.000 0.000 N Il13ra2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.