Transcript: Mouse NM_001306088.1

Mus musculus dynamin binding protein (Dnmbp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Dnmbp (71972)
Length:
3908
CDS:
159..2630

Additional Resources:

NCBI RefSeq record:
NM_001306088.1
NBCI Gene record:
Dnmbp (71972)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001306088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192763 CGTACAGAGAATAATGCGTTA pLKO.1 662 CDS 100% 4.050 5.670 N Dnmbp n/a
2 TRCN0000329046 CCAAGGCAGTGACTCTATAAA pLKO_005 2348 CDS 100% 15.000 10.500 N Dnmbp n/a
3 TRCN0000329105 CTACGTCCCATCCAACTATAT pLKO_005 2588 CDS 100% 13.200 9.240 N Dnmbp n/a
4 TRCN0000189782 GCTACGTCCCATCCAACTATA pLKO.1 2587 CDS 100% 13.200 9.240 N Dnmbp n/a
5 TRCN0000202219 CACCCGGATAAAGTGCCTTTA pLKO.1 726 CDS 100% 10.800 7.560 N Dnmbp n/a
6 TRCN0000375295 TCGCCGTCAAGGAGATCAATG pLKO_005 760 CDS 100% 10.800 7.560 N Dnmbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.