Transcript: Human NM_001306193.1

Homo sapiens FERM domain containing 7 (FRMD7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
FRMD7 (90167)
Length:
3166
CDS:
177..2276

Additional Resources:

NCBI RefSeq record:
NM_001306193.1
NBCI Gene record:
FRMD7 (90167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001306193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416672 AGGGTTCCAGTTTCCGCTATA pLKO_005 1015 CDS 100% 10.800 15.120 N FRMD7 n/a
2 TRCN0000437216 GCAAGGCAAGGTGGGTATTTG pLKO_005 2510 3UTR 100% 13.200 9.240 N FRMD7 n/a
3 TRCN0000134941 CCCAAGGAATATCAGAATGAA pLKO.1 1733 CDS 100% 5.625 3.938 N FRMD7 n/a
4 TRCN0000138811 GAGGGCAAGATCATGCACTTT pLKO.1 594 CDS 100% 4.950 3.465 N FRMD7 n/a
5 TRCN0000136077 GCCAGACATAAACCAGATGAA pLKO.1 2927 3UTR 100% 4.950 3.465 N FRMD7 n/a
6 TRCN0000136300 GCTGAAGAATGGTGACAGTAT pLKO.1 2590 3UTR 100% 4.950 3.465 N FRMD7 n/a
7 TRCN0000135031 CCAGACATAAACCAGATGAAA pLKO.1 2928 3UTR 100% 5.625 3.375 N FRMD7 n/a
8 TRCN0000135030 CCAGTAGAAATGGTCTTGTAA pLKO.1 2734 3UTR 100% 5.625 3.375 N FRMD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.