Transcript: Mouse NM_001308537.1

Mus musculus MAS-related GPR, member A6 (Mrgpra6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mrgpra6 (381886)
Length:
1016
CDS:
62..967

Additional Resources:

NCBI RefSeq record:
NM_001308537.1
NBCI Gene record:
Mrgpra6 (381886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001308537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173359 GAACTTCCTTACTACCGCATA pLKO.1 547 CDS 100% 4.050 5.670 N Mrgpra6 n/a
2 TRCN0000175003 GAATTTAGTCTTTATCTGGCA pLKO.1 767 CDS 100% 0.660 0.924 N Mrgpra6 n/a
3 TRCN0000242278 GTCTCTATTGCTCTGCATTCT pLKO_005 463 CDS 100% 4.950 3.960 N Mrgpra6 n/a
4 TRCN0000242280 TAGCTTCCACAGAGCATATTC pLKO_005 249 CDS 100% 13.200 9.240 N Mrgpra6 n/a
5 TRCN0000176039 GTCTAGCAATGAACTTCCTTA pLKO.1 537 CDS 100% 4.950 3.465 N Mrgpra6 n/a
6 TRCN0000242276 TTGGATACCAAATATGAAGAT pLKO_005 506 CDS 100% 4.950 3.465 N Mrgpra6 n/a
7 TRCN0000242277 TGATCGTCATCCTCGGACTAG pLKO_005 105 CDS 100% 4.050 2.835 N Mrgpra6 n/a
8 TRCN0000215768 GATGAAGCTTACCAGATTATA pLKO.1 643 CDS 100% 15.000 9.000 N Mrgpra6 n/a
9 TRCN0000215941 CCAACAGTATCTTTATCAACT pLKO.1 285 CDS 100% 4.950 3.465 N Mrgpra6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.