Transcript: Mouse NM_001309374.1

Mus musculus predicted gene 10037 (Gm10037), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-24
Taxon:
Mus musculus (mouse)
Gene:
Gm10037 (102637366)
Length:
549
CDS:
52..327

Additional Resources:

NCBI RefSeq record:
NM_001309374.1
NBCI Gene record:
Gm10037 (102637366)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001309374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096714 GTGTGGTTAGAGCTGTTGTAT pLKO.1 373 3UTR 100% 5.625 7.875 N n/a
2 TRCN0000096715 ACAACAGTCTACTGGTGTGAA pLKO.1 222 CDS 100% 4.950 3.465 N n/a
3 TRCN0000096718 CTGGAGAATTACAGCCACCTT pLKO.1 145 CDS 100% 2.640 1.320 Y n/a
4 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 136 CDS 100% 13.200 6.600 Y Zfp874a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001309374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.