Transcript: Human NM_001310327.2

Homo sapiens iron-sulfur cluster assembly factor IBA57 (IBA57), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
IBA57 (200205)
Length:
7515
CDS:
280..771

Additional Resources:

NCBI RefSeq record:
NM_001310327.2
NBCI Gene record:
IBA57 (200205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001310327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149567 GCGACTGATTCCCTTACTTTA pLKO.1 6757 3UTR 100% 13.200 18.480 N IBA57 n/a
2 TRCN0000149174 CCCTCTGTCATACAAACCAAA pLKO.1 3041 3UTR 100% 4.950 3.960 N IBA57 n/a
3 TRCN0000146902 CCTCTGTCATACAAACCAAAT pLKO.1 3042 3UTR 100% 10.800 7.560 N IBA57 n/a
4 TRCN0000149315 GCAGTTGTGTTATGTGGGTAT pLKO.1 3303 3UTR 100% 4.050 2.835 N IBA57 n/a
5 TRCN0000149021 GCATTTACATTCCCACCAGAA pLKO.1 6966 3UTR 100% 4.050 2.835 N IBA57 n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5229 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5226 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.