Transcript: Mouse NM_001310461.1

Mus musculus cysteine-rich perinuclear theca 1 (Cypt1), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-10-26
Taxon:
Mus musculus (mouse)
Gene:
Cypt1 (66742)
Length:
663
CDS:
25..531

Additional Resources:

NCBI RefSeq record:
NM_001310461.1
NBCI Gene record:
Cypt1 (66742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310461.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176888 GCATTCTTCTCTCATAAGAAT pLKO.1 430 CDS 100% 0.563 0.338 N Cypt1 n/a
2 TRCN0000449888 AGAAGAATTAGGAGACAATTG pLKO_005 340 CDS 100% 10.800 5.400 Y Cypt1 n/a
3 TRCN0000453016 CGCTGTCGTTGTTGCTGTTAC pLKO_005 217 CDS 100% 10.800 5.400 Y Cypt1 n/a
4 TRCN0000440770 GCCTTGACAGTGACCCATTTC pLKO_005 485 CDS 100% 10.800 5.400 Y Cypt1 n/a
5 TRCN0000182418 GCGAGATTACAGTGGCATTCT pLKO.1 416 CDS 100% 4.950 2.475 Y Cypt1 n/a
6 TRCN0000441522 AGCCAACTGGAGCTGATCGAA pLKO_005 367 CDS 100% 3.000 1.500 Y Cypt1 n/a
7 TRCN0000182362 GAAGCTTGAGAAGACCACCAA pLKO.1 96 CDS 100% 2.640 1.320 Y Cypt1 n/a
8 TRCN0000176535 CAAGAGATCTTCACACTCTTT pLKO.1 162 CDS 100% 0.495 0.248 Y Cypt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310461.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.