Transcript: Mouse NM_001310464.1

Mus musculus reelin (Reln), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Reln (19699)
Length:
11696
CDS:
298..10677

Additional Resources:

NCBI RefSeq record:
NM_001310464.1
NBCI Gene record:
Reln (19699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424102 TGTTGGTCACCGAGCTATTTA pLKO_005 11031 3UTR 100% 15.000 21.000 N Reln n/a
2 TRCN0000413408 GGTCAGGATCATGTCGATTTA pLKO_005 1106 CDS 100% 13.200 18.480 N Reln n/a
3 TRCN0000120628 CCGTACAATAATGGTAAGAAA pLKO.1 6085 CDS 100% 5.625 7.875 N Reln n/a
4 TRCN0000120627 CCGTGGAAATTGTGATCTGTT pLKO.1 10889 3UTR 100% 4.950 6.930 N Reln n/a
5 TRCN0000120631 GCTCGGATGAAAGGAGTTCTA pLKO.1 10486 CDS 100% 4.950 6.930 N Reln n/a
6 TRCN0000120629 CCAGGATACATGATGCAATTT pLKO.1 9646 CDS 100% 13.200 9.240 N Reln n/a
7 TRCN0000437265 CCGAGAACACTGCACTCTATT pLKO_005 9065 CDS 100% 13.200 9.240 N Reln n/a
8 TRCN0000428273 TGAGCCTACTGTCTATTATAC pLKO_005 4365 CDS 100% 13.200 9.240 N Reln n/a
9 TRCN0000120630 CCAGAAATACACTCCTCACAT pLKO.1 3111 CDS 100% 4.950 3.465 N Reln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.