Transcript: Mouse NM_001310465.1

Mus musculus phosphodiesterase 4C, cAMP specific (Pde4c), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pde4c (110385)
Length:
3305
CDS:
166..2226

Additional Resources:

NCBI RefSeq record:
NM_001310465.1
NBCI Gene record:
Pde4c (110385)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310465.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054648 GCATGTGCTATACACGACGTA pLKO.1 1438 CDS 100% 2.640 2.112 N Pde4c n/a
2 TRCN0000054652 AGAGTGGTATCAGAGTAGGAT pLKO.1 2061 CDS 100% 3.000 2.100 N Pde4c n/a
3 TRCN0000054649 GAGTTGTCTTACCTGTCGGAA pLKO.1 901 CDS 100% 2.640 1.848 N Pde4c n/a
4 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 2982 3UTR 100% 2.640 1.320 Y Adsl n/a
5 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 2982 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310465.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.