Transcript: Mouse NM_001310511.1

Mus musculus canopy FGF signaling regulator 1 (Cnpy1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cnpy1 (269637)
Length:
3760
CDS:
896..1180

Additional Resources:

NCBI RefSeq record:
NM_001310511.1
NBCI Gene record:
Cnpy1 (269637)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191745 GAAGATGAGATATTCGAACTT pLKO.1 1070 CDS 100% 4.950 6.930 N Cnpy1 n/a
2 TRCN0000249329 GGCAAACCATCTAGCTGATAT pLKO_005 1102 CDS 100% 13.200 10.560 N Cnpy1 n/a
3 TRCN0000192976 GCTGATATGCTGTGCAATGAA pLKO.1 1115 CDS 100% 5.625 4.500 N Cnpy1 n/a
4 TRCN0000200897 CTAGCTGATATGCTGTGCAAT pLKO.1 1112 CDS 100% 4.950 3.960 N Cnpy1 n/a
5 TRCN0000249328 AGATGAGATATTCGAACTTAT pLKO_005 1072 CDS 100% 13.200 9.240 N Cnpy1 n/a
6 TRCN0000249330 AGTGACCAAGCAGAAGTATTT pLKO_005 931 CDS 100% 13.200 9.240 N Cnpy1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.