Transcript: Mouse NM_001310601.1

Mus musculus biorientation of chromosomes in cell division 1-like (Bod1l), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Bod1l (665775)
Length:
10399
CDS:
148..9105

Additional Resources:

NCBI RefSeq record:
NM_001310601.1
NBCI Gene record:
Bod1l (665775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242375 ATTGTTCATGGACGGTATTAT pLKO_005 9267 3UTR 100% 15.000 21.000 N Bod1l n/a
2 TRCN0000242373 GTCTGGTATTGACCGAATTAT pLKO_005 525 CDS 100% 15.000 21.000 N Bod1l n/a
3 TRCN0000242371 GAGCTAAGTTAGCATCAATTA pLKO_005 3101 CDS 100% 13.200 18.480 N Bod1l n/a
4 TRCN0000242372 GCTCGTTGCCATGATCGTAAA pLKO_005 297 CDS 100% 10.800 15.120 N Bod1l n/a
5 TRCN0000242374 CCAAGCAGATGAGTCCAATAA pLKO_005 8694 CDS 100% 13.200 10.560 N Bod1l n/a
6 TRCN0000181138 CCCAGTGCTAATGTAGCCAAT pLKO.1 718 CDS 100% 4.050 2.835 N BOD1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.