Transcript: Mouse NM_001310623.1

Mus musculus formin-like 3 (Fmnl3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Fmnl3 (22379)
Length:
4183
CDS:
181..3111

Additional Resources:

NCBI RefSeq record:
NM_001310623.1
NBCI Gene record:
Fmnl3 (22379)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236021 GTCCGATTCATTCGTTCTTAC pLKO_005 2782 CDS 100% 10.800 15.120 N FMNL3 n/a
2 TRCN0000120510 GCTGGTGGATTACCTGTCATT pLKO.1 594 CDS 100% 4.950 6.930 N Fmnl3 n/a
3 TRCN0000339730 GCTGGTGGATTACCTGTCATT pLKO_005 594 CDS 100% 4.950 6.930 N Fmnl3 n/a
4 TRCN0000339732 TACTCTTCGGAGGCTCATTAA pLKO_005 1383 CDS 100% 13.200 10.560 N Fmnl3 n/a
5 TRCN0000120507 CCCAAGTCTTCAACTTCATTT pLKO.1 3306 3UTR 100% 13.200 9.240 N Fmnl3 n/a
6 TRCN0000351102 CCCAAGTCTTCAACTTCATTT pLKO_005 3306 3UTR 100% 13.200 9.240 N Fmnl3 n/a
7 TRCN0000120511 CGCAAGAAACAAGAGGAGGTA pLKO.1 2830 CDS 100% 2.640 1.848 N Fmnl3 n/a
8 TRCN0000120508 GCTGCCTTTGACAATTTCAAA pLKO.1 889 CDS 100% 0.563 0.394 N Fmnl3 n/a
9 TRCN0000339731 GCTGCCTTTGACAATTTCAAA pLKO_005 889 CDS 100% 0.563 0.394 N Fmnl3 n/a
10 TRCN0000179511 GAGAGCATCAAGGAGACATAT pLKO.1 1339 CDS 100% 13.200 7.920 N FMNL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.