Transcript: Mouse NM_001310646.1

Mus musculus TSC22 domain family, member 1 (Tsc22d1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tsc22d1 (21807)
Length:
5016
CDS:
924..3911

Additional Resources:

NCBI RefSeq record:
NM_001310646.1
NBCI Gene record:
Tsc22d1 (21807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218486 GTATGTAGTGTAACGAATTTG pLKO_005 4571 3UTR 100% 13.200 18.480 N Tsc22d1 n/a
2 TRCN0000374229 GGTGCAAGTGTGGTAGCTATC pLKO_005 3609 CDS 100% 6.000 4.800 N Tsc22d1 n/a
3 TRCN0000374168 TGAGTGAATTAAAGGTTAATC pLKO_005 4112 3UTR 100% 13.200 9.240 N Tsc22d1 n/a
4 TRCN0000374228 CCAGTATTAAGCACTCATAAG pLKO_005 4065 3UTR 100% 10.800 7.560 N Tsc22d1 n/a
5 TRCN0000013289 GCAGGAGAACAATCTGCTGAA pLKO.1 3752 CDS 100% 4.050 2.835 N TSC22D1 n/a
6 TRCN0000086179 GAGCAGATCAAAGAACTAATA pLKO.1 3711 CDS 100% 13.200 7.920 N Tsc22d1 n/a
7 TRCN0000234092 GAGCAGATCAAAGAACTAATA pLKO_005 3711 CDS 100% 13.200 7.920 N Tsc22d1 n/a
8 TRCN0000086182 GTTCTGAAGGAGCAGATCAAA pLKO.1 3702 CDS 100% 5.625 3.375 N Tsc22d1 n/a
9 TRCN0000329852 GGTGCAAGTGTGGTAGCTATT pLKO_005 3609 CDS 100% 10.800 8.640 N TSC22D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.