Transcript: Mouse NM_001310717.1

Mus musculus matrix metallopeptidase 27 (Mmp27), mRNA.

Source:
NCBI, updated 2017-05-25
Taxon:
Mus musculus (mouse)
Gene:
Mmp27 (234911)
Length:
2132
CDS:
63..1640

Additional Resources:

NCBI RefSeq record:
NM_001310717.1
NBCI Gene record:
Mmp27 (234911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087681 CGGATTTCCAAGACGTGTGAA pLKO.1 1208 CDS 100% 4.950 3.960 N Mmp27 n/a
2 TRCN0000052291 CCAGTTCTACTCTCTTGAAAT pLKO.1 218 CDS 100% 13.200 9.240 N MMP27 n/a
3 TRCN0000087678 GCAGGGAAGTTATGTTCTTTA pLKO.1 982 CDS 100% 13.200 9.240 N Mmp27 n/a
4 TRCN0000087679 CCACTGACGTTTACCAGGATA pLKO.1 531 CDS 100% 4.950 3.465 N Mmp27 n/a
5 TRCN0000087680 CCAGGCATATCTCAACCAGTT pLKO.1 203 CDS 100% 4.050 2.835 N Mmp27 n/a
6 TRCN0000087682 CAATGATCAAACAGCCTTGAT pLKO.1 788 CDS 100% 0.495 0.347 N Mmp27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.