Transcript: Mouse NM_001310754.1

Mus musculus heat shock transcription factor 3 (Hsf3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hsf3 (245525)
Length:
2824
CDS:
1..1479

Additional Resources:

NCBI RefSeq record:
NM_001310754.1
NBCI Gene record:
Hsf3 (245525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096572 GATCATCAGTATTTCCGTATT pLKO.1 640 CDS 100% 10.800 15.120 N Hsf3 n/a
2 TRCN0000096570 GCATTGAATTATGACTCTGAT pLKO.1 1096 CDS 100% 4.950 6.930 N Hsf3 n/a
3 TRCN0000096569 GCCATCTCATATACAATCAAA pLKO.1 2012 3UTR 100% 5.625 3.938 N Hsf3 n/a
4 TRCN0000096573 CTAAGGATATTTCTCTGGAAT pLKO.1 935 CDS 100% 4.950 3.465 N Hsf3 n/a
5 TRCN0000096571 CACAAATGAAACAGGACTATT pLKO.1 449 CDS 100% 13.200 7.920 N Hsf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.