Transcript: Mouse NM_001311159.1

Mus musculus F-box and WD-40 domain protein 14 (Fbxw14), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-10-26
Taxon:
Mus musculus (mouse)
Gene:
Fbxw14 (50757)
Length:
1340
CDS:
38..1279

Additional Resources:

NCBI RefSeq record:
NM_001311159.1
NBCI Gene record:
Fbxw14 (50757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311159.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253977 TGCTGGCTCTTTGGATATATA pLKO_005 1078 CDS 100% 15.000 7.500 Y Fbxw14 n/a
2 TRCN0000253976 ATCGGGAACAAAGTAACTATT pLKO_005 845 CDS 100% 13.200 6.600 Y Fbxw14 n/a
3 TRCN0000253975 GTGTTATCGACTACGAAATAG pLKO_005 1132 CDS 100% 13.200 6.600 Y Fbxw14 n/a
4 TRCN0000253974 TCGGGCACATCCATGGTATAT pLKO_005 334 CDS 100% 13.200 6.600 Y Fbxw14 n/a
5 TRCN0000192570 GCCAGAAGATTTCACTTACAA pLKO.1 289 CDS 100% 5.625 2.813 Y Fbxw20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311159.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.